[ 1 / 174 page. ] This SNP table is available from the DOWNLOAD page (SNP.xls).
Reference Map Taibyosobutori Yumehomare Sakurajima AZ26H N1-3 Nishimachiriso Sayatori total_REF total_ALT MAF
Primer# (Zou et al. 2013) POS scaffold# POS REF Linkage group cM ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total ALT QUAL PLUS MINUS REF+ REF- ALT+ ALT- Total
CL666 11 Rsa1.0_00492.1 70803 C R6 73.95 C + 30 1 30 1 0 0 31 C + 78 0 78 0 0 0 78 C + 34 0 34 0 0 0 34 C + 56 0 56 0 0 0 56 C + 158 0 158 0 0 0 158 C + 81 0 81 0 0 0 81 C/G 83 10 7 3 2 7 5 17 443 12 0.026
CL666 25 Rsa1.0_00492.1 70817 C R6 73.95 C + 31 1 31 1 0 0 32 C + 81 0 81 0 0 0 81 C + 38 2 38 2 0 0 40 C + 57 0 57 0 0 0 57 C + 164 0 164 0 0 0 164 C + 83 0 83 0 0 0 83 C/A 75 19 10 6 6 13 4 29 469 17 0.035
CL666 71 Rsa1.0_00492.1 70863 A R6 73.95 A + 0 12 0 12 0 0 12 A + 3 13 3 13 0 0 16 A + 2 38 2 38 0 0 40 A + 0 8 0 8 0 0 8 A + 4 6 4 6 0 0 10 A + 2 11 2 11 0 0 13 A/G 91 34 19 13 11 21 8 53 123 29 0.191
CL666 73 Rsa1.0_00492.1 70865 C R6 73.95 C + 0 12 0 12 0 0 12 C + 2 13 2 13 0 0 15 C + 2 36 2 36 0 0 38 C + 0 8 0 8 0 0 8 C + 3 6 3 6 0 0 9 C + 1 11 1 11 0 0 12 C/A 85 36 18 14 11 22 7 54 119 29 0.196
CL666 80 Rsa1.0_00492.1 70872 C R6 73.95 C + 1 14 1 14 0 0 15 C + 1 14 1 14 0 0 15 C + 2 38 2 38 0 0 40 C + 0 8 0 8 0 0 8 C + 1 7 1 7 0 0 8 C + 0 11 0 11 0 0 11 C/T 88 36 19 14 11 22 8 55 122 30 0.197
CL666 102 Rsa1.0_00492.1 70894 C R6 73.95 C + 1 14 1 14 0 0 15 C + 1 9 1 9 0 0 10 C + 0 12 0 12 0 0 12 C + 0 3 0 3 0 0 3 C + 1 4 1 4 0 0 5 C + 0 6 0 6 0 0 6 C/A 83 37 18 16 11 21 7 55 78 28 0.264
CL666 106 Rsa1.0_00492.1 70898 G R6 73.95 G + 1 10 1 10 0 0 11 G + 1 10 1 10 0 0 11 G + 0 11 0 11 0 0 11 G + 0 6 0 6 0 0 6 G + 1 4 1 4 0 0 5 G + 0 3 0 3 0 0 3 G/C 61 34 15 16 11 18 4 49 74 22 0.229
CL666 113 Rsa1.0_00492.1 70905 T R6 73.95 T + 1 26 1 26 0 0 27 G 89 1 17 0 0 1 17 18 T + 0 51 0 51 0 0 51 G 53 0 9 0 0 0 9 9 G 84 1 16 0 0 1 16 17 T + 0 14 0 14 0 0 14 T/G 57 19 9 9 6 10 3 28 107 57 0.348
CL666 121 Rsa1.0_00492.1 70913 A R6 73.95 A + 1 29 1 29 0 0 30 A + 1 46 1 46 0 0 47 A + 0 67 0 67 0 0 67 A + 0 26 0 26 0 0 26 A + 1 73 1 73 0 0 74 A + 0 25 0 25 0 0 25 A/C 22 21 8 12 7 9 1 29 288 10 0.034
CL666 144 Rsa1.0_00492.1 70936 T R6 73.95 T + 0 27 0 27 0 0 27 T + 0 45 0 45 0 0 45 T/C 19.1 0 67 0 25 0 42 67 T + 0 26 0 26 0 0 26 T + 2 74 2 74 0 0 76 T/C 22 0 27 0 16 0 11 27 T + 11 7 11 7 0 0 18 233 53 0.185
CL666 150 Rsa1.0_00492.1 70942 A R6 73.95 A/C 34 1 26 1 10 0 16 27 A + 1 43 1 43 0 0 44 A + 2 69 2 69 0 0 71 A + 0 27 0 27 0 0 27 A + 2 75 2 75 0 0 77 A/C 20 0 28 0 17 0 11 28 A + 11 9 11 9 0 0 20 267 27 0.092
CL666 203 Rsa1.0_00492.1 70995 T R6 73.95 T + 34 0 34 0 0 0 34 C 92 28 3 0 0 28 3 31 T + 64 0 64 0 0 0 64 C 75 15 1 0 0 15 1 16 C 59 14 0 0 0 14 0 14 T + 13 1 13 1 0 0 14 T + 7 13 7 13 0 0 20 132 61 0.316
CL666 213 Rsa1.0_00492.1 71005 C R6 73.95 C + 34 0 34 0 0 0 34 C + 29 2 29 2 0 0 31 C + 65 0 65 0 0 0 65 C + 15 0 15 0 0 0 15 C + 15 0 15 0 0 0 15 C + 12 1 12 1 0 0 13 C/T 20 7 14 6 8 1 6 21 187 7 0.036
CL666 222 Rsa1.0_00492.1 71014 A R6 73.95 A + 1 0 1 0 0 0 1 A + 6 1 6 1 0 0 7 A + 1 3 1 3 0 0 4 A + 4 0 4 0 0 0 4 A + 3 0 3 0 0 0 3 A + 1 2 1 2 0 0 3 A/G 25 5 14 4 8 1 6 19 34 7 0.171
CL666 234 Rsa1.0_00492.1 71026 A R6 73.95 A + 2 11 2 11 0 0 13 A + 6 13 6 13 0 0 19 A + 2 32 2 32 0 0 34 A + 3 8 3 8 0 0 11 A + 4 5 4 5 0 0 9 A + 3 8 3 8 0 0 11 A/T 5.46 3 12 3 7 0 5 15 107 5 0.045
CL666 246 Rsa1.0_00492.1 71038 G R6 73.95 G + 10 11 10 11 0 0 21 A 133 4 12 0 0 4 12 16 G + 10 32 10 32 0 0 42 A 94 2 8 0 0 2 8 10 A 98 4 5 0 0 4 5 9 G + 4 8 4 8 0 0 12 G + 3 11 3 11 0 0 14 89 35 0.282
CL666 264 Rsa1.0_00492.1 71056 T R6 73.95 T + 18 12 18 12 0 0 30 T + 3 13 3 13 0 0 16 T + 10 32 10 32 0 0 42 T + 2 8 2 8 0 0 10 T + 3 7 3 7 0 0 10 T + 4 9 4 9 0 0 13 T/C 42 2 9 1 3 1 6 11 125 7 0.053
CL666 276 Rsa1.0_00492.1 71068 T R6 73.95 T + 16 12 16 12 0 0 28 T + 2 13 2 13 0 0 15 T + 9 29 9 29 0 0 38 T + 1 8 1 8 0 0 9 T + 1 7 1 7 0 0 8 T + 2 8 2 8 0 0 10 T/C 3.54 1 6 1 3 0 3 7 112 3 0.026
CL666 285 Rsa1.0_00492.1 71077 C R6 73.95 C + 16 1 16 1 0 0 17 A 9.31 1 1 0 0 1 1 2 C + 9 0 9 0 0 0 9 C + 1 0 1 0 0 0 1 A 25 1 2 0 0 1 2 3 C + 2 2 2 2 0 0 4 C + 2 3 2 3 0 0 5 36 5 0.122
CL672 117 Rsa1.0_00821.1 49103 C R1 10.88 C + 63 61 63 61 0 0 124 - - 0 0 0 0 0 0 0 C + 0 1 0 1 0 0 1 A 25 1 2 0 0 1 2 3 C + 99 71 99 71 0 0 170 C/A 28.7 2 3 0 1 2 2 5 A 72 10 1 0 0 10 1 11 296 18 0.057
CL672 137 Rsa1.0_00821.1 49123 T R1 10.88 T + 4 70 4 70 0 0 74 - - 0 0 0 0 0 0 0 T + 0 1 0 1 0 0 1 A 6.02 0 2 0 0 0 2 2 T + 2 84 2 84 0 0 86 T + 0 3 0 3 0 0 3 A 80 7 2 0 0 7 2 9 164 11 0.063
CL672 186 Rsa1.0_00821.1 49172 T R1 10.88 T + 30 318 30 318 0 0 348 T + 0 3 0 3 0 0 3 T + 0 4 0 4 0 0 4 C 6.02 0 2 0 0 0 2 2 T + 15 545 15 545 0 0 560 C 57 0 11 0 0 0 11 11 C 76 6 2 0 0 6 2 8 915 21 0.022
CL672 200 Rsa1.0_00821.1 49186 A R1 10.88 A + 204 131 204 131 0 0 335 A + 0 1 0 1 0 0 1 A + 2 3 2 3 0 0 5 C 17.1 0 3 0 0 0 3 3 A + 35 160 35 160 0 0 195 C 35.3 0 5 0 0 0 5 5 C 60.1 4 2 0 0 4 2 6 536 14 0.025
CL672 202 Rsa1.0_00821.1 49188 T R1 10.88 T + 204 130 204 130 0 0 334 T + 0 1 0 1 0 0 1 T + 2 3 2 3 0 0 5 C 17.1 0 3 0 0 0 3 3 T + 35 159 35 159 0 0 194 C 35.3 0 5 0 0 0 5 5 C 60.1 4 2 0 0 4 2 6 534 14 0.026
CL672 233 Rsa1.0_00821.1 49219 T R1 10.88 T + 427 37 427 37 0 0 464 - - 0 0 0 0 0 0 0 T + 3 1 3 1 0 0 4 T + 0 1 0 1 0 0 1 T + 37 37 37 37 0 0 74 C 27.5 0 4 0 0 0 4 4 C 54.3 2 3 0 0 2 3 5 543 9 0.016
CL672 241 Rsa1.0_00821.1 49227 C R1 10.88 C + 454 30 454 30 0 0 484 - - 0 0 0 0 0 0 0 C + 3 0 3 0 0 0 3 - - 0 0 0 0 0 0 0 C + 39 26 39 26 0 0 65 G 17.1 0 3 0 0 0 3 3 G 54.3 2 3 0 0 2 3 5 552 8 0.014
CL672 255 Rsa1.0_00821.1 49241 G R1 10.88 G + 822 1 822 1 0 0 823 G + 1 0 1 0 0 0 1 G + 3 0 3 0 0 0 3 - - 0 0 0 0 0 0 0 G + 33 2 33 2 0 0 35 C 41.1 6 0 0 0 6 0 6 C 25 1 2 0 0 1 2 3 862 9 0.010
CL672 259 Rsa1.0_00821.1 49245 G R1 10.88 G + 822 4 822 4 0 0 826 G + 1 0 1 0 0 0 1 G + 3 0 3 0 0 0 3 - - 0 0 0 0 0 0 0 G + 33 5 33 5 0 0 38 C 41.1 6 0 0 0 6 0 6 C 25 1 2 0 0 1 2 3 868 9 0.010
CL672 271 Rsa1.0_00821.1 49257 GCTTCTTCT R1 10.88 GCTTCTTCT + 821 103 821 103 0 0 924 GCTTCTTCT + 1 1 1 1 0 0 2 GCTTCTTCT + 3 1 3 1 0 0 4 GCTTCTTCT + 0 1 0 1 0 0 1 GCTTCTTCT + 33 20 33 20 0 0 53 GCTTCT 68.5 6 2 0 0 6 2 8 GCTTCTTCT + 0 2 0 2 0 0 2 986 8 0.008
CL675 71 Rsa1.0_03465.1 10858 G G + 56 25 56 25 0 0 81 G + 137 6 137 6 0 0 143 G + 83 10 83 10 0 0 93 C 121 111 8 0 0 111 8 119 G + 690 3 690 3 0 0 693 G + 144 2 144 2 0 0 146 G + 4 3 4 3 0 0 7 1163 119 0.093
CL675 268 Rsa1.0_03465.1 11055 A A + 223 3 223 3 0 0 226 A + 233 0 233 0 0 0 233 A + 168 1 168 1 0 0 169 A + 205 0 205 0 0 0 205 A + 768 1 768 1 0 0 769 A + 39 1 39 1 0 0 40 A/T 15.5 2 2 1 0 1 2 4 1643 3 0.002
CL675 288 Rsa1.0_03465.1 11075 TTGGGGGG TTGGGGGG + 2 1 2 1 0 0 3 TTGGGGGG + 4 0 4 0 0 0 4 TTGGGGGG + 3 0 3 0 0 0 3 TTGGGGGG + 1 0 1 0 0 0 1 TTGGGGGG + 1 0 1 0 0 0 1 - - 0 0 0 0 0 0 0 T 3.66 1 1 0 0 1 1 2 12 2 0.143
CL675 376 Rsa1.0_03465.1 11163 T T + 1 337 1 337 0 0 338 T + 0 317 0 317 0 0 317 T + 1 435 1 435 0 0 436 T + 1 308 1 308 0 0 309 T + 0 609 0 609 0 0 609 T + 0 199 0 199 0 0 199 C 19 1 2 0 0 1 2 3 2208 3 0.001
CL675 386 Rsa1.0_03465.1 11173 G G + 1 336 1 336 0 0 337 G + 0 316 0 316 0 0 316 G + 1 434 1 434 0 0 435 G + 1 307 1 307 0 0 308 G + 0 609 0 609 0 0 609 G + 0 197 0 197 0 0 197 T 6.02 0 2 0 0 0 2 2 2202 2 0.001
CL677 34 Rsa1.0_04286.1 4110 C C + 111 12 111 12 0 0 123 T 6.02 2 0 0 0 2 0 2 - - 0 0 0 0 0 0 0 C + 106 5 106 5 0 0 111 C + 1 0 1 0 0 0 1 C + 108 8 108 8 0 0 116 - - 0 0 0 0 0 0 0 351 2 0.006
CL677 45 Rsa1.0_04286.1 4121 A A + 111 12 111 12 0 0 123 G 6.02 2 0 0 0 2 0 2 - - 0 0 0 0 0 0 0 A + 106 6 106 6 0 0 112 A + 1 0 1 0 0 0 1 A + 108 8 108 8 0 0 116 - - 0 0 0 0 0 0 0 352 2 0.006
CL677 207 Rsa1.0_04286.1 4283 G G + 10 4 10 4 0 0 14 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 G + 8 3 8 3 0 0 11 - - 0 0 0 0 0 0 0 G + 14 2 14 2 0 0 16 A 54.3 2 3 0 0 2 3 5 41 5 0.109
CL677 227 Rsa1.0_04286.1 4303 G G + 1 68 1 68 0 0 69 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 G + 1 50 1 50 0 0 51 - - 0 0 0 0 0 0 0 G + 3 62 3 62 0 0 65 G/C 38 6 6 4 2 2 4 12 191 6 0.030
CL677 230 Rsa1.0_04286.1 4306 T T + 3 69 3 69 0 0 72 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 T + 1 50 1 50 0 0 51 - - 0 0 0 0 0 0 0 T + 2 62 2 62 0 0 64 C 120 6 6 0 0 6 6 12 187 12 0.060
CL677 234 Rsa1.0_04286.1 4310 A A + 3 69 3 69 0 0 72 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 A + 1 48 1 48 0 0 49 - - 0 0 0 0 0 0 0 A + 3 62 3 62 0 0 65 G 88 3 5 0 0 3 5 8 186 8 0.041
CL677 238 Rsa1.0_04286.1 4314 C C + 3 69 3 69 0 0 72 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 C + 1 49 1 49 0 0 50 - - 0 0 0 0 0 0 0 C + 4 62 4 62 0 0 66 A 88 3 5 0 0 3 5 8 188 8 0.041
CL677 240 Rsa1.0_04286.1 4316 G G + 3 69 3 69 0 0 72 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 G + 1 49 1 49 0 0 50 - - 0 0 0 0 0 0 0 G + 4 62 4 62 0 0 66 A 88 3 5 0 0 3 5 8 188 8 0.041
CL677 243 Rsa1.0_04286.1 4319 T T + 3 69 3 69 0 0 72 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 T + 2 48 2 48 0 0 50 - - 0 0 0 0 0 0 0 T + 4 62 4 62 0 0 66 C 88 3 5 0 0 3 5 8 188 8 0.041
CL677 245 Rsa1.0_04286.1 4321 T T + 3 69 3 69 0 0 72 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 T + 3 48 3 48 0 0 51 - - 0 0 0 0 0 0 0 T + 4 62 4 62 0 0 66 "G,C" 53.1 3 5 0 0 3 5 8 189 8 0.041
CL677 293 Rsa1.0_04286.1 4369 T T + 36 2 36 2 0 0 38 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 T + 117 2 117 2 0 0 119 - - 0 0 0 0 0 0 0 T + 67 2 67 2 0 0 69 "C,A" 39.1 6 6 0 0 6 6 12 226 12 0.050
CL677 302 Rsa1.0_04286.1 4378 A A + 37 2 37 2 0 0 39 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 A + 121 2 121 2 0 0 123 - - 0 0 0 0 0 0 0 A + 67 2 67 2 0 0 69 A/T 45.1 4 4 0 2 4 2 8 233 6 0.025
CL677 369 Rsa1.0_04286.1 4445 T T + 15 2 15 2 0 0 17 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 T + 7 3 7 3 0 0 10 - - 0 0 0 0 0 0 0 T + 7 4 7 4 0 0 11 C 4.61 1 1 0 0 1 1 2 38 2 0.050
CL677 464 Rsa1.0_04286.1 4540 G C 139 0 287 0 0 0 287 287 C 27.5 0 4 0 0 0 4 4 C 6.02 0 2 0 0 0 2 2 C 84 0 144 0 0 0 144 144 G + 0 1 0 1 0 0 1 C 72 0 115 0 0 0 115 115 G + 1 2 1 2 0 0 3 4 552 0.007
CL685 70 Rsa1.0_00890.1 158922 A R1 87.9 A/C 5.46 1 5 1 2 0 3 6 A + 0 4 0 4 0 0 4 A + 0 1 0 1 0 0 1 A + 0 3 0 3 0 0 3 - - 0 0 0 0 0 0 0 A + 1 3 1 3 0 0 4 A + 11 7 11 7 0 0 18 33 3 0.083
CL685 91 Rsa1.0_00890.1 158943 TATACA R1 87.9 TATACA + 0 3 0 3 0 0 3 TATACA + 3 11 3 11 0 0 14 TATACA + 6 1 6 1 0 0 7 TATACA + 5 1 5 1 0 0 6 TATACA + 8 6 8 6 0 0 14 TATACA + 4 1 4 1 0 0 5 TATACA/TA 44.5 12 9 7 5 5 4 21 61 9 0.129
CL685 147 Rsa1.0_00890.1 158999 ATTTT R1 87.9 ATTTT + 2 42 2 42 0 0 44 ATTTT + 15 53 15 53 0 0 68 ATTT 152 6 43 0 0 6 43 49 ATTT 105 2 21 0 0 2 21 23 ATTT 155 39 23 0 0 39 23 62 ATTT 148 7 15 0 0 7 15 22 ATTTT/ATTT 41.5 12 5 7 2 5 3 17 121 164 0.425
CL685 166 Rsa1.0_00890.1 159018 G R1 87.9 G + 44 3 44 3 0 0 47 G + 99 6 99 6 0 0 105 A 77 81 2 0 0 81 2 83 A 54 32 0 0 0 32 0 32 A 88 94 3 0 0 94 3 97 A 53 38 0 0 0 38 0 38 A 111 6 5 0 0 6 5 11 152 261 0.368
CL685 200 Rsa1.0_00890.1 159052 T R1 87.9 T + 79 1 79 1 0 0 80 T + 130 7 130 7 0 0 137 C 66 75 1 0 0 75 1 76 C 54 31 0 0 0 31 0 31 C 53 55 0 0 0 55 0 55 C 54 31 0 0 0 31 0 31 T/C 3.01 7 2 5 1 2 1 9 223 196 0.468
CL685 271 Rsa1.0_00890.1 159123 G R1 87.9 G + 1 61 1 61 0 0 62 G + 4 69 4 69 0 0 73 A 49 1 35 0 0 1 35 36 A 41 0 14 0 0 0 14 14 A 43 0 27 0 0 0 27 27 A 49 1 7 0 0 1 7 8 G/A 12.3 8 3 6 1 2 2 11 142 89 0.385
CL685 275 Rsa1.0_00890.1 159127 C R1 87.9 C + 1 61 1 61 0 0 62 C + 4 69 4 69 0 0 73 A 49 1 35 0 0 1 35 36 A 43 0 15 0 0 0 15 15 A 43 0 27 0 0 0 27 27 A 49 1 7 0 0 1 7 8 C/A 9.52 9 3 7 1 2 2 12 143 90 0.386
CL685 484 Rsa1.0_00890.1 159336 CACAAAG R1 87.9 CACAAAG + 5 48 5 48 0 0 53 CACAAAG + 6 128 6 128 0 0 134 CACAAAG + 8 73 8 73 0 0 81 CACAAAG + 2 67 2 67 0 0 69 CACAAAG + 1 229 1 229 0 0 230 CACAAAG + 3 105 3 105 0 0 108 CACAAAGCCGGCATCAACAAAG 16.5 2 1 0 0 2 1 3 675 3 0.004
CL694 43 Rsa1.0_00324.1 189456 A R5 65.46 A + 608 33 608 33 0 0 641 A + 172 0 172 0 0 0 172 A + 500 1 500 1 0 0 501 A/C 80 141 0 1 0 140 0 141 A/C 69 95 1 1 0 94 1 96 A/C 136 318 0 2 0 316 0 318 - - 0 0 0 0 0 0 0 1318 551 0.295
CL694 46 Rsa1.0_00324.1 189459 ACC R5 65.46 ACC + 608 191 608 191 0 0 799 ATTTGCC 9.9 3 0 0 0 3 0 3 ACC + 500 1 500 1 0 0 501 ACC + 141 0 141 0 0 0 141 ACC + 95 1 95 1 0 0 96 ACC + 318 0 318 0 0 0 318 - - 0 0 0 0 0 0 0 1855 3 0.002
CL694 91 Rsa1.0_00324.1 189504 TGGGG R5 65.46 TGGGG + 8 166 8 166 0 0 174 TGGG 10.2 5 0 0 0 5 0 5 TGGG 8.61 4 0 0 0 4 0 4 TGGG 31.5 8 0 0 0 8 0 8 TGGG 23.5 11 0 0 0 11 0 11 TGGG 16.6 7 0 0 0 7 0 7 - - 0 0 0 0 0 0 0 174 35 0.167
CL694 181 Rsa1.0_00324.1 189594 G R5 65.46 G + 1 80 1 80 0 0 81 A 79 1 9 0 0 1 9 10 G/A 55.5 1 8 0 1 1 7 9 A 25 1 2 0 0 1 2 3 A 58 0 12 0 0 0 12 12 A 71 1 7 0 0 1 7 8 A 6.02 2 0 0 0 2 0 2 82 43 0.344
CL694 188 Rsa1.0_00324.1 189601 A R5 65.46 A + 0 70 0 70 0 0 70 A + 1 9 1 9 0 0 10 A + 0 7 0 7 0 0 7 A + 1 1 1 1 0 0 2 A + 0 12 0 12 0 0 12 A + 1 7 1 7 0 0 8 T 6.02 2 0 0 0 2 0 2 109 2 0.018
CL694 240 Rsa1.0_00324.1 189653 T R5 65.46 T + 112 38 112 38 0 0 150 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 G 6.02 2 0 0 0 2 0 2 150 2 0.013
CL694 277 Rsa1.0_00324.1 189690 A R5 65.46 A + 33 1 33 1 0 0 34 - - 0 0 0 0 0 0 0 T 6.02 2 0 0 0 2 0 2 A + 1 0 1 0 0 0 1 - - 0 0 0 0 0 0 0 A + 2 0 2 0 0 0 2 A + 1 0 1 0 0 0 1 38 2 0.050
CL694 281 Rsa1.0_00324.1 189694 GGA R5 65.46 GGA/GGAACTGA 19.5 15 0 7 0 8 0 15 GGA + 3 0 3 0 0 0 3 GGA + 2 0 2 0 0 0 2 GGA + 2 1 2 1 0 0 3 - - 0 0 0 0 0 0 0 GGA + 2 0 2 0 0 0 2 GGA + 1 0 1 0 0 0 1 18 8 0.308
CL694 298 Rsa1.0_00324.1 189711 T R5 65.46 T + 90 21 90 21 0 0 111 T/C 154 35 23 2 0 33 23 58 C 153 81 21 0 0 81 21 102 C 140 19 8 0 0 19 8 27 T/C 118 11 10 2 0 9 10 21 T/C 147 29 14 1 0 28 14 43 - - 0 0 0 0 0 0 0 116 246 0.320
CL697 1 Rsa1.0_00409.1 1550 G R5 136.88 G + 29 0 29 0 0 0 29 G + 94 0 94 0 0 0 94 G + 93 0 93 0 0 0 93 G + 48 0 48 0 0 0 48 G + 40 0 40 0 0 0 40 G + 85 0 85 0 0 0 85 A 24 2 1 0 0 2 1 3 389 3 0.008
CL697 2 Rsa1.0_00409.1 1551 C R5 136.88 C + 30 0 30 0 0 0 30 C + 94 0 94 0 0 0 94 C + 93 0 93 0 0 0 93 C + 48 0 48 0 0 0 48 C + 41 0 41 0 0 0 41 C + 86 0 86 0 0 0 86 "G,A" 5.29 2 1 0 0 2 1 3 392 3 0.008
CL697 4 Rsa1.0_00409.1 1553 T R5 136.88 T + 30 0 30 0 0 0 30 T + 94 0 94 0 0 0 94 T + 93 0 93 0 0 0 93 T + 48 0 48 0 0 0 48 T + 42 0 42 0 0 0 42 T + 90 0 90 0 0 0 90 A 24 2 1 0 0 2 1 3 397 3 0.008
CL698 21 Rsa1.0_03257.1 15618 A A + 180 5 180 5 0 0 185 A + 86 1 86 1 0 0 87 A + 48 0 48 0 0 0 48 A + 138 2 138 2 0 0 140 A + 140 1 140 1 0 0 141 A + 67 0 67 0 0 0 67 G 6.02 2 0 0 0 2 0 2 668 2 0.003
CL698 31 Rsa1.0_03257.1 15628 A A + 183 9 183 9 0 0 192 A + 86 1 86 1 0 0 87 T 53 48 0 0 0 48 0 48 A + 139 3 139 3 0 0 142 A + 140 3 140 3 0 0 143 A + 67 2 67 2 0 0 69 T 6.02 2 0 0 0 2 0 2 633 50 0.073
CL698 35 Rsa1.0_03257.1 15632 G G + 183 13 183 13 0 0 196 G + 86 1 86 1 0 0 87 T 53 49 0 0 0 49 0 49 G + 139 4 139 4 0 0 143 G + 141 6 141 6 0 0 147 G + 67 3 67 3 0 0 70 T 6.02 2 0 0 0 2 0 2 643 51 0.073
CL698 64 Rsa1.0_03257.1 15661 C C + 54 72 54 72 0 0 126 G 17.1 3 0 0 0 3 0 3 G 80 7 2 0 0 7 2 9 C + 11 25 11 25 0 0 36 C + 4 13 4 13 0 0 17 C + 6 9 6 9 0 0 15 G 6.02 2 0 0 0 2 0 2 194 14 0.067
CL698 157 Rsa1.0_03257.1 15754 TGA TGA + 0 179 0 179 0 0 179 TGAGA 8.15 3 0 0 0 3 0 3 TGA + 2 0 2 0 0 0 2 TGA + 6 171 6 171 0 0 177 TGA + 3 130 3 130 0 0 133 TGA + 2 43 2 43 0 0 45 - - 0 0 0 0 0 0 0 536 3 0.006
CL698 158 Rsa1.0_03257.1 15755 G G + 0 179 0 179 0 0 179 G + 6 0 6 0 0 0 6 G + 3 0 3 0 0 0 3 T 222 6 168 0 0 6 168 174 G + 2 130 2 130 0 0 132 G + 2 43 2 43 0 0 45 - - 0 0 0 0 0 0 0 365 174 0.323
CL698 230 Rsa1.0_03257.1 15827 T - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 G 40.5 2 2 0 0 2 2 4 T + 1 2 1 2 0 0 3 T + 1 1 1 1 0 0 2 T + 0 3 0 3 0 0 3 G 17.1 3 0 0 0 3 0 3 8 7 0.467
CL698 256 Rsa1.0_03257.1 15853 A A + 1 4 1 4 0 0 5 - - 0 0 0 0 0 0 0 A + 1 0 1 0 0 0 1 A + 1 0 1 0 0 0 1 A + 1 2 1 2 0 0 3 A + 1 1 1 1 0 0 2 T 17.1 3 0 0 0 3 0 3 12 3 0.200
CL698 272 Rsa1.0_03257.1 15869 G G + 2 69 2 69 0 0 71 G/A 12.9 0 5 0 1 0 4 5 G/A 4.99 0 4 0 1 0 3 4 G + 1 284 1 284 0 0 285 G + 1 235 1 235 0 0 236 G + 2 153 2 153 0 0 155 A 17.1 3 0 0 0 3 0 3 749 10 0.013
CL698 274 Rsa1.0_03257.1 15871 C C + 2 69 2 69 0 0 71 C/G 12.9 0 5 0 1 0 4 5 C/G 11 0 5 0 1 0 4 5 C + 1 284 1 284 0 0 285 C + 1 235 1 235 0 0 236 C + 2 153 2 153 0 0 155 G 17.1 3 0 0 0 3 0 3 749 11 0.014
CL698 278 Rsa1.0_03257.1 15875 GAAAA GAAAA + 2 69 2 69 0 0 71 GAAAA + 0 36 0 36 0 0 36 GAAAAAAA 51.5 0 14 0 0 0 14 14 GAAAA + 1 284 1 284 0 0 285 GAAAA + 1 235 1 235 0 0 236 GAAAA + 2 153 2 153 0 0 155 GAAAA + 3 0 3 0 0 0 3 786 14 0.018
CL701 102 Rsa1.0_01196.1 26615 C R6 35.99 C/T 46 87 17 51 11 36 6 104 C/T 35 96 5 44 3 52 2 101 C/T 22 92 9 47 8 45 1 101 C + 84 5 84 5 0 0 89 C/T 30 109 3 60 2 49 1 112 C + 71 8 71 8 0 0 79 C + 1 19 1 19 0 0 20 414 192 0.317
CL701 186 Rsa1.0_01196.1 26699 A R6 35.99 A + 7 16 7 16 0 0 23 A + 3 20 3 20 0 0 23 A/G 14.2 5 16 3 12 2 4 21 A + 2 3 2 3 0 0 5 A + 2 35 2 35 0 0 37 G 60.1 6 1 0 0 6 1 7 A + 0 9 0 9 0 0 9 112 13 0.104
CL701 191 Rsa1.0_01196.1 26704 CTTTTCATTT R6 35.99 CTTT 57.5 1 6 0 0 1 6 7 CTTT 74.5 1 10 0 0 1 10 11 CTTT 20 0 4 0 0 0 4 4 CTTTTCATTT + 2 3 2 3 0 0 5 CTTT 96.5 2 11 0 0 2 11 13 CTTTTCATTT + 7 1 7 1 0 0 8 CTTTTCATTT + 0 9 0 9 0 0 9 22 35 0.386
CL701 241 Rsa1.0_01196.1 26754 C R6 35.99 C + 69 35 69 35 0 0 104 C + 33 16 33 16 0 0 49 C + 52 44 52 44 0 0 96 C + 2 2 2 2 0 0 4 C + 51 8 51 8 0 0 59 C + 4 3 4 3 0 0 7 C/T 33 6 7 2 5 4 2 13 326 6 0.018
CL701 245 Rsa1.0_01196.1 26758 C R6 35.99 C + 71 36 71 36 0 0 107 C + 33 15 33 15 0 0 48 C + 52 44 52 44 0 0 96 C + 2 2 2 2 0 0 4 C + 51 8 51 8 0 0 59 C + 4 3 4 3 0 0 7 C/T 33 6 7 2 5 4 2 13 328 6 0.018
CL701 250 Rsa1.0_01196.1 26763 C R6 35.99 C + 71 35 71 35 0 0 106 C + 33 18 33 18 0 0 51 C + 52 46 52 46 0 0 98 C + 2 2 2 2 0 0 4 C + 52 9 52 9 0 0 61 C + 4 3 4 3 0 0 7 C/A 41 6 4 2 2 4 2 10 331 6 0.018
CL701 256 Rsa1.0_01196.1 26769 CTTTT R6 35.99 CTTT 77.5 1 29 0 0 1 29 30 CTTT 51.5 0 15 0 0 0 15 15 CTTTT + 52 290 52 290 0 0 342 CTTTT + 2 55 2 55 0 0 57 CTTTT + 52 37 52 37 0 0 89 CTTTT + 4 48 4 48 0 0 52 CTTTT + 7 4 7 4 0 0 11 551 45 0.076
CL701 260 Rsa1.0_01196.1 26773 T R6 35.99 T + 118 123 118 123 0 0 241 T + 66 81 66 81 0 0 147 T + 90 190 90 190 0 0 280 T/A 27 2 24 2 4 0 20 26 T + 101 31 101 31 0 0 132 T + 4 21 4 21 0 0 25 T/A 47 7 4 2 2 5 2 11 835 27 0.031
CL701 261 Rsa1.0_01196.1 26774 A R6 35.99 A + 118 92 118 92 0 0 210 A + 66 67 66 67 0 0 133 A + 90 150 90 150 0 0 240 A/C 27 2 24 2 4 0 20 26 A + 101 25 101 25 0 0 126 A/C 31 4 21 4 3 0 18 25 A/C 47 7 4 2 2 5 2 11 726 45 0.058
CL701 262 Rsa1.0_01196.1 26775 A R6 35.99 A + 118 115 118 115 0 0 233 A + 66 87 66 87 0 0 153 A + 91 249 91 249 0 0 340 A + 2 54 2 54 0 0 56 A + 101 31 101 31 0 0 132 A + 4 47 4 47 0 0 51 A/T 47 7 4 2 2 5 2 11 969 7 0.007
CL701 268 Rsa1.0_01196.1 26781 TGGGGG R6 35.99 TGGGGG + 118 115 118 115 0 0 233 TGGGGG + 66 87 66 87 0 0 153 TGGGGG + 91 250 91 250 0 0 341 TGGGGG + 2 54 2 54 0 0 56 TGGGGGG 45.5 41 0 0 0 41 0 41 TGGGGG + 4 47 4 47 0 0 51 TGGGGG + 7 4 7 4 0 0 11 845 41 0.046
CL701 274 Rsa1.0_01196.1 26787 C R6 35.99 C + 118 115 118 115 0 0 233 C + 66 87 66 87 0 0 153 C + 91 251 91 251 0 0 342 C/A 48 2 54 1 4 1 50 56 C + 101 30 101 30 0 0 131 C + 4 47 4 47 0 0 51 C/A 62.3 7 3 2 0 5 3 10 917 59 0.060
CL701 336 Rsa1.0_01196.1 26849 C R6 35.99 C + 261 44 261 44 0 0 305 C + 65 39 65 39 0 0 104 C + 141 26 141 26 0 0 167 C/T 24 46 1 3 1 43 0 47 C + 14 33 14 33 0 0 47 C/T 31 62 3 3 2 59 1 65 C + 7 6 7 6 0 0 13 645 103 0.138
CL701 391 Rsa1.0_01196.1 26904 TAAAA R6 35.99 TAAA 153 2 175 0 0 2 175 177 TAAA 109 1 141 0 0 1 141 142 TAAA 134 1 194 0 0 1 194 195 TAAA 9.9 0 3 0 0 0 3 3 TAAA 53.5 0 88 0 0 0 88 88 TAAA 20 0 4 0 0 0 4 4 TAAAA + 2 3 2 3 0 0 5 5 609 0.008
CL706 26 Rsa1.0_00015.1 527905 A R1 40.32 A + 36 6 36 6 0 0 42 A + 36 6 36 6 0 0 42 A/C 47 68 10 30 7 38 3 78 A/C 130 210 3 1 0 209 3 213 C 124 216 1 0 0 216 1 217 C 108 194 0 0 0 194 0 194 C 6.02 2 0 0 0 2 0 2 122 666 0.155
CL706 143 Rsa1.0_00015.1 528022 C R1 40.32 C + 2 4 2 4 0 0 6 C + 4 7 4 7 0 0 11 C/T 35 16 0 4 0 12 0 16 T 59 13 0 0 0 13 0 13 T 27.5 4 0 0 0 4 0 4 T 60 16 0 0 0 16 0 16 T 6.02 2 0 0 0 2 0 2 21 47 0.309
CL706 168 Rsa1.0_00015.1 528047 A R1 40.32 - - 0 0 0 0 0 0 0 A + 1 4 1 4 0 0 5 A + 2 1 2 1 0 0 3 A + 4 0 4 0 0 0 4 A + 2 1 2 1 0 0 3 A + 9 0 9 0 0 0 9 C 52.3 3 2 0 0 3 2 5 24 5 0.172
CL706 178 Rsa1.0_00015.1 528057 G R1 40.32 - - 0 0 0 0 0 0 0 G + 2 2 2 2 0 0 4 G/A 3.64 2 1 1 0 1 1 3 A 27.5 4 0 0 0 4 0 4 A 24 2 1 0 0 2 1 3 A 53 9 0 0 0 9 0 9 A 66.1 3 3 0 0 3 3 6 5 24 0.172
CL706 189 Rsa1.0_00015.1 528068 A R1 40.32 - - 0 0 0 0 0 0 0 A + 2 1 2 1 0 0 3 A/C 31.5 8 0 1 0 7 0 8 C 60 16 0 0 0 16 0 16 C 67 30 1 0 0 30 1 31 C 52 38 0 0 0 38 0 38 C 66.1 3 3 0 0 3 3 6 4 98 0.039
CL706 234 Rsa1.0_00015.1 528113 CATTAGATTATTAGA R1 40.32 - - 0 0 0 0 0 0 0 CATTAGATTATTAGA + 0 3 0 3 0 0 3 CATTAGATTATTAGA + 15 0 15 0 0 0 15 CATTAGATTATTAGA + 59 0 59 0 0 0 59 CATTAGATTATTAGA + 57 0 57 0 0 0 57 CATTAGATTATTAGA + 193 0 193 0 0 0 193 CATTAGA 17.5 1 2 0 0 1 2 3 327 3 0.009
CL706 255 Rsa1.0_00015.1 528134 A R1 40.32 - - 0 0 0 0 0 0 0 A + 3 3 3 3 0 0 6 A + 2 0 2 0 0 0 2 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 - - 0 0 0 0 0 0 0 T 17.1 0 3 0 0 0 3 3 8 3 0.273

1

Go to page.